missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Cytiva GST Vector Primers for Sequencing
Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence
1505.00 NOK - 1532.00 NOK
Specifications
For Use With (Equipment) | Glutathione S-transferase (GST) gene fusion system |
---|---|
Content And Storage | -20°C |
Quantity | 260 U |
For Use With (Application) | Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors |
Description
- Provided ready for immediate use
- pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
- pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’
Specifications
Glutathione S-transferase (GST) gene fusion system | |
-20°C | |
260 U | |
Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors |
Spot an opportunity for improvement?Share a Content Correction
Product Content Correction
Your input is important to us. Please complete this form to provide feedback related to the content on this product.
Product Title