missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Cytiva GST Vector Primers for Sequencing
Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence
Brand: Cytiva 27-1411-01
This item is not returnable.
View return policy
Description
- Provided ready for immediate use
- pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
- pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’
Specifications
Glutathione S-transferase (GST) gene fusion system | |
pGEX 3′ Sequencing | |
Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors |
-20°C | |
260 U |
Product Content Correction
Your input is important to us. Please complete this form to provide feedback related to the content on this product.
Product Title
Spot an opportunity for improvement?Share a Content Correction