missing translation for 'onlineSavingsMsg'
Learn More

Cytiva GST Vector Primers for Sequencing

Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence

Brand: Cytiva 27-1410-01

View more versions of this product

Product Code. 10774157

This item is currently unavailable or has been discontinued.
View the product page for possible alternatives.
View alternative products »

This item is not returnable. View return policy

Description

Provided ready for immediate use
pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’

Specifications

For Use With (Equipment)	Glutathione S-transferase (GST) gene fusion system
Primer	pGEX 5′ Sequencing
For Use With (Application)	Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors

Content And Storage	-20°C
Quantity	260 U

Product Suggestions

Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title

Your Name

Email Address *

Type of Issue *

Detailed Description of Issue/Request *

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Cancel Submit

Thank You! Your feedback has been submitted. Fisher Scientific is always working to improve our content for you. We appreciate your feedback.

Spot an opportunity for improvement?Share a Content Correction

Cytiva GST Vector Primers for Sequencing

Description

Specifications

Product Suggestions

Documents

Special Offers